Community
    • Login

    UDL syntax highlighting: non-delimited keywords (for nucleotide sequences)

    Scheduled Pinned Locked Moved General Discussion
    20 Posts 5 Posters 1.7k Views
    Loading More Posts
    • Oldest to Newest
    • Newest to Oldest
    • Most Votes
    Reply
    • Reply as topic
    Log in to reply
    This topic has been deleted. Only users with topic management privileges can see it.
    • N ielsN
      N iels
      last edited by

      For highlighting individual nucleotides in biochemical sequence files, I would like to color the individual characters A, C, T, and G in in a sequence like “ACTGagcttcgAGgt” in different colors. This would be very important for manually aligning similar sequences in different lines.
      Unfortunately, this is currently not possible using the UDL syntax highlighting system (Menu :: Language :: Define your language). Please could you make this possible? E.g. by allowing non-delimited keywords, that are inside of continuous text? This could simply be done by another checkbox on top of the keyword list groups. Thanks in advance!

      1 Reply Last reply Reply Quote 0
      • PeterJonesP
        PeterJones
        last edited by

        @N-iels ,

        You can add extra highlighting to a UDL language using regexes via the script EnhanceUDLLexer.py that @Ekopalypse shares in this linked post

        If that’s not sufficient (though I think it will be), this FAQ explains the correct procedure for feature requests.

        1 Reply Last reply Reply Quote 1
        • N ielsN
          N iels
          last edited by

          @PeterJones: Thanks for your quick reply. I have opened the following feature request: https://github.com/notepad-plus-plus/notepad-plus-plus/issues/7622.
          For a quick solution, I would like to experiment with the regexp solution, but I am not sure what to do with that Python script. Please could you point me in the right direction?

          1 Reply Last reply Reply Quote 0
          • PeterJonesP
            PeterJones
            last edited by

            @N-iels ,

            If you don’t have PythonScript installed yet, you’ll need to install it. See @Ekopalypse 's post here for how to install the most-recent PythonScript 1.52 into Notepad++ 7.7.1, 7.8, or 7.8.1. Exit Notepad++ and reload after installing PythonScript to be able to see it.

            Once you have PythonScript installed, Plugins > Python Script > New Script, give it a name (EnhanceUDLLexer.py), paste the contents of the script and save. You would then have to edit the regexes[...] defintion section. I’ve recommended his scripts a lot, but never used one myself, so I’d just have a guess:

            #   Set A, C, T, G to red, green, blue, and yellow.
            regexes[(0, (255, 0, 0))] = (r'A', 0)   # A:red
            regexes[(1, (0, 255, 0))] = (r'C', 0)   # C:green
            regexes[(2, (0, 0, 255))] = (r'T', 0)   # T:blue
            regexes[(3, (255,255,0))] = (r'G', 0)   # G:yellow
            

            Save those changes. (Those regexes could be made more complex to be able to ensure that the highlighting would only match the character when it was in a string composed of ACTG characters, and/or to require case or ignore case; if you need further refinement to the regexes, you’ll need to carefully define your requirements. However, first you should focus on getting the basic functionality working; that way, when you make the regexes more complex, you’ll be able to see what change you made that caused the highlighting to “go wrong”, assuming it doesn’t work perfectly the first try. :-) )

            If you use Plugins > Python Script > Scripts > EnhanceUDLLexer, it should apply that extra formatting for this load of Notepad++. If you don’t want to have to manually run the script every time you load Notepad++, I believe you can add a call to startup.py, but @Ekopalypse would have to chime in with the right syntax for that.

            1 Reply Last reply Reply Quote 2
            • guy038G
              guy038
              last edited by guy038

              Hello, @n-iels, @peterjones and All,

              Edited 2019-11-21 : Sorry, @n-iels, as I’m French, I used the wrong term ADN, instead of DNA !

              Of course the Peter’s solution, using @ekopalypse Python code, is quite robust but, may be, this macro, below, could help you to study your ADN sequences ;-)). Roughly, this macro :

              • First, execute the command Search > Unmark All > Clear All Styles

              • Then, write the ATGC upper-cased string, at beginning of the current line

              • Mark, successively the 4 letters A , T, G and C with, respectively, the styles 1, 2, 3, and 5

              • Re-select the ATGC string, at beginning of current line

              • Delete the ATGC string, leaving the contents of current line untouched !

              => As a result, all the ADN sequences of the current file should be highlighted, with the 4 different styles ;-))


              So :

              • Start Notepad++

              • Open the shortcuts.xml configuration file, generally located in %AppData%\Roaming\Notepad++ for an installed N++ version or in the same folder than the Notepad++.exe file, in case of a local installation with a zip or 7z package

              • Insert the code, below, in the <Macros>......</Macros section of shortcuts.xml

                      <Macro name="ADN Test" Ctrl="no" Alt="no" Shift="no" Key="0">
                          <Action type="2" message="0"    wParam="43032" lParam="0" sParam=""  />   <!--  DELETE ALL styles        -->
                          <Action type="0" message="2453" wParam="0"     lParam="0" sParam=""  />   <!--  Go to START of line      -->
                          <Action type="1" message="2170" wParam="0"     lParam="0" sParam="A" />   <!--  Write the letter A       -->
                          <Action type="1" message="2170" wParam="0"     lParam="0" sParam="T" />   <!--  Write the letter T       -->
                          <Action type="1" message="2170" wParam="0"     lParam="0" sParam="G" />   <!--  Write the letter G       -->
                          <Action type="1" message="2170" wParam="0"     lParam="0" sParam="C" />   <!--  Write the letter C       -->
                          <Action type="0" message="2453" wParam="0"     lParam="0" sParam=""  />   <!--  Go to START of line      -->
                          <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     -->
                          <Action type="2" message="0"    wParam="43022" lParam="0" sParam=""  />   <!--  Apply the 1st STYLE      -->
                          <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        -->
                          <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     -->
                          <Action type="2" message="0"    wParam="43024" lParam="0" sParam=""  />   <!--  Apply the 2nd STYLE      -->
                          <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        -->
                          <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     -->
                          <Action type="2" message="0"    wParam="43026" lParam="0" sParam=""  />   <!--  Apply the 3rd STYLE      -->
                          <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        -->
                          <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     -->
                          <Action type="2" message="0"    wParam="43030" lParam="0" sParam=""  />   <!--  Apply the 5th STYLE      -->
                          <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        -->
                          <Action type="0" message="2454" wParam="0"     lParam="0" sParam=""  />   <!--  Select to START of line  -->
                          <Action type="0" message="2180" wParam="0"     lParam="0" sParam=""  />   <!--  Hit on the DELETE key    -->
                      </Macro>
              
              • Then save the modifications ( Ctrl + S ) and close shortcuts.xml ( Ctrl + W )

              • Now, stop and re-start N++

              • Open any file containing some ADN sequences

              • If some ADN sequences contained lower-cased letters :

                • Open the Find dialog, with Search > Find... ( Ctrl + F )

                • Untick, if necessary, the Match case option

                • Hit the ESC key to close the Find dialog

              • Execute this macro, running the command Macro > ADN Test, which should be visible, along with your present macros, if any ( You may assign a shortcut, as well )

              Et voilà ;-))

              Best Regards,

              guy038

              1 Reply Last reply Reply Quote 3
              • Alan KilbornA
                Alan Kilborn
                last edited by

                @guy038 always tries out my proposed solutions to problems, so this time I tried @guy038 's solution and it works nicely. First I obtained some data to try it on from here. Then, executing the macro on the data resulted in this nicely visual view:

                d66b57e5-e0bd-4fb7-9887-a4470e557043-image.png

                Perhaps the only note to make is that, upon any future change to shortcuts.xml that is made automatically by Notepad++, will cause @guy038 's nice comments on each line of the macro to be removed! :-(

                1 Reply Last reply Reply Quote 2
                • Alan KilbornA
                  Alan Kilborn
                  last edited by

                  To give @Ekopalypse fair time as well, I decided to try the lexing script.

                  Here’s what I did:

                  • Create a barebones UDL called ADNTest. I changed/added nothing, just saved an “empty” definition.

                  • Get the latest version I could ascertain of the EnhanceUDLLexer.py file. [Sadly, the thread linked to (above by Peter) for this starts out with I opened this thread just to inform you that I have reworked the script a little bit. Such an opening is begging for a link to an original discussion thread!]

                  • Modify that file as follows:

                  1. lexer_name = 'ADNTest'

                  2. Comment out existing regexes variable settings (from the Examples section) and add in the following ones (using some “random” color numbers):

                  regexes[(0, (252, 173, 67))] = (r'a', 0)
                  regexes[(1, (152, 73, 167))] = (r'g', 0)
                  regexes[(2, (52, 37, 176))] = (r'c', 0)
                  regexes[(3, (25, 17, 77))] = (r't', 0)
                  
                  • Run the script.

                  • Generate some random DNA data from the link provided earlier by me into a new Notepad++ tab.

                  • Change the Language of the tab to be my ADNTest UDL.

                  It worked nicely, giving me this view of the data:

                  a823e1eb-8506-49df-936b-bd98d6946241-image.png

                  Overall, perhaps I give the nod to @guy038’s solution because it is a lot simpler for someone to use that isn’t already using Pythonscript.

                  1 Reply Last reply Reply Quote 2
                  • Alan KilbornA
                    Alan Kilborn
                    last edited by Alan Kilborn

                    Note: I just picked up and used the term ADN from what @guy038 started, and I ran with it, without paying much attention. I think this really should have been DNA! Perhaps @guy038 is dyslexic – no, no, that can’t be…he’d never be a regex expert if that were the case. :-)

                    1 Reply Last reply Reply Quote 3
                    • PeterJonesP
                      PeterJones
                      last edited by

                      @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                      @guy038 is dyslexic – no

                      Actually, @guy038 is French. “DNA”:“Deoxyribonucleic acid”::“ADN”:“acide désoxyribonucléique”, per a quick google search.

                      1 Reply Last reply Reply Quote 2
                      • PeterJonesP
                        PeterJones
                        last edited by

                        @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                        regexes[(0, (252, 173, 67))] = (r’a’, 0)
                        regexes[(1, (152, 73, 167))] = (r’g’, 0)
                        regexes[(2, (52, 37, 176))] = (r’c’, 0)
                        regexes[(3, (25, 17, 77))] = (r’t’, 0)

                        I finally gave in and actually tried using the script. It does work fairly easily, like you showed.

                        I confirmed with the following data that it is case sensitive.

                        gattaca
                        acctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        GATACCGCTGGACCTAAAAGCGAGGGGACTTCTGGGCGGCGTATCCAA
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctggacctaaaagcgaggggacttctgggcggcgtatccaa
                        gataccgctgg
                        

                        Thus,

                        regexes[(0, (252, 173, 67))] = (r'[Aa]', 0)
                        regexes[(1, (152, 73, 167))] = (r'[Gg]', 0)
                        regexes[(2, (52, 37, 176))] = (r'[Cc]', 0)
                        regexes[(3, (25, 17, 77))] = (r'[Tt]', 0)
                        

                        will use Alan’s same colours, but allow lower case or upper case.

                        To make it automatic, I added the following to the startup.py (by Plugins > Python Script > Scripts, then Ctrl+Click on startup)

                        # to automatically import eko's EnhanceUDLLexer:
                        d = notepad.getPluginConfigDir() + '\\PythonScript\\scripts\\'
                        sys.path.append(d)
                        import EnhanceUDLLexer
                        EnhanceUDLLexer.EnhanceUDLLexer().main()
                        

                        When you exit and reload Notepad++, DNA files should now automatically be colored.

                        However, as Alan said, @guy038’s macro is probably easier to use for someone who doesn’t already use PythonScript (or for anytime that Notepad++ updates break PythonScript notifications/callbacks).

                        1 Reply Last reply Reply Quote 3
                        • guy038G
                          guy038
                          last edited by guy038

                          Hello, @n-iels, @alan-kilborn, @peterjones and All,

                          Thanks, Alan, for your kind words ! Yes, Peter is just right about it : ADN ( “Acide désoxyribonucléique” ) is simply the French initialism for DNA ( “Deoxyribonucleic acid” ). So, I’m not thinking, yet, as native English-American people ? My bad ;-))

                          By the way, do you know the difference between an acronym and an initialism ?

                          
                          Acronym             Signification                                 Syntactic details                                  Pronunciation
                          ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
                           GIF         Graphics Interchange Format      Pure acronym, formed from initial letters                             As a SINGLE word
                           Radar       Radio Detection And Ranging      Pure acronym, formed from both initial and non-initial letters        As a SINGLE word
                           CD-ROM      Compact Disc Read-Only Memory    Both, acronym and initialism, formed from initial letters              _C_  _D_  _Rom_
                           DNA         DeoxyriboNucleic Acid            Pure initialism, formed from both initial and non-initial letters      _D_  _N_  _A_
                           HTML        HyperText Markup Language        Pure initialism, formed from both initial and non-initial letters      _H_  _T_  _M_  _L_
                           VHF         Very High Frequency”             Pure initialism, formed from initial letters                           _V_  _H_  _F_  
                          
                          From :  https://en.wikipedia.org/wiki/Acronym#Nomenclature
                          
                          and  :  https://en.wikipedia.org/wiki/Acronym#Comparing_a_few_examples_of_each_type
                          

                          Now, regarding the macro, I simply used the default N++ colors of the Mark styles. I just avoided the 4th style, which seems too dark purple, to my mind ! Of course, all these style colors can be changed in Settings > Style Configurator... > Global styles > Mark Style #1 to #5 ;-))

                          Best Regards,

                          guy038

                          Alan KilbornA 1 Reply Last reply Reply Quote 1
                          • Alan KilbornA
                            Alan Kilborn @guy038
                            last edited by

                            @guy038 said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                            do you know the difference between an acronym and an initialism

                            I don’t. I still don’t. And I don’t know why it is important enough for their to be a distinction. :-)

                            1 Reply Last reply Reply Quote 0
                            • guy038G
                              guy038
                              last edited by guy038

                              Hi, @alan-kilborn and All,

                              When I was elaborating my answer to you, about the "ADN -DNA" difference, I thought , of course, about the French name acronyme to describe these things, with the intention of choosing the correct English word, afterwards, which I would had inserted in my post.

                              So, after a search on wikipedia.fr I was surprised to learn that different kinks of acronyms exist. Particularly, the two main families :

                              • True acronyms, ( French word : acronymes ), which are pronounced as a single word
                              • Pseudo acronyms,called initialisms ( French word : sigles ), which are pronounced as individual letters

                              For instance, in the Wikipedia article, it it said :

                              … some dictionaries and usage commentators define acronym to mean an abbreviation that is pronounced as a word, in contrast to an initialism (or alphabetism)‍—‌an abbreviation formed from a string of initials (and possibly pronounced as individual letters)…

                              So, it’s out of curiosity that I noticed these differences. Just consider that @guy038’s mind was rather creating a useless story ;-)) And, of course, absolutely no relation at all with Notepad++ and @n-iels problem ;-))

                              Last remark :

                              I have often noticed that people who know several languages are more respectful of their own language ! For example, I don’t like the “Frenglish” terms. In my opinion, it’s just an honor to speak and write well in each language ! Of course, I do understand that no language is really fixed and everyone evolves on their own ;-))

                              Best Regards

                              guy038

                              N ielsN 1 Reply Last reply Reply Quote 1
                              • N ielsN
                                N iels @guy038
                                last edited by

                                Thanks, you are amazing… I have now tried both solutions:

                                The Python script by @Ekopalypse works nicely, but has the following problems:

                                1. It slows Notepad++ down dramatically, to the point that working with a medium-size sequence file (500 k chars, mostly dashes) becomes impossible.
                                2. The script does not allow you to style the background. But background styling is what we usually want for this purpose.
                                3. Also, I noticed, that you cannot invoke the script twice (e.g. after changing colors).

                                BTW, the standard colors that I prefer would be:

                                regexes[(0, (224,   0,   0))] = (r'[tTuU]', 0) # red
                                regexes[(1, (  2, 140,   0))] = (r'[aA]'  , 0) # green
                                regexes[(2, (  0,   0, 230))] = (r'[cC]'  , 0) # blue
                                # regexes[(3, (  0,   0,   0))] = (r'[gG]'  , 0) # black (default)
                                

                                As for the macro by @guy038:

                                1. It is much faster and actually makes editing the sequence file from above possible.
                                2. But on one of my computers, the A’s are not styled (I still have the standard colors set in the style configurator).
                                3. Understanding and editing the macro code is almost impossible and I could not find a useful macro documentation that is online (most links point to the now defunct npp wiki). It would be nice to have the same algorithm in Python Script…
                                4. The macro is not dynamic, i.e. after editing your sequences, you have to manually re-invoke that macro. Until then, your new sequence is styled wrong or not at all.

                                Both solutions allow me to finish my current project (thanks again!). But the preferable solution for non-hackers would be to make this a standard language (“Nucleotides”) after enhancing the UDL highlighter as discussed on the bug tracker: https://github.com/notepad-plus-plus/notepad-plus-plus/issues/7622.

                                EkopalypseE Alan KilbornA PeterJonesP 3 Replies Last reply Reply Quote 2
                                • EkopalypseE
                                  Ekopalypse @N iels
                                  last edited by Ekopalypse

                                  @N-iels

                                  Thank you very much for the testing and feedback of the test results.
                                  I’m afraid your use case reaches the limits of the script.
                                  Since the script only colors the current visual area, you seem to have very long lines with many hits, which leads to delays.
                                  The script is currently using, as you mentioned earlier, the
                                  textforeground indicator, this could be changed to get the same format as Guy’s solution.
                                  A restart of the script can be accomplished by deleting the class EnhanceUDLLexer via the PythonScript Console,
                                  with del EnhanceUDLLexer and another start.

                                  Can you tell me how much data you currently have, i.e. how long individual lines are in the visual area?
                                  I’d like to see if it’s possible to optimize the script, but I’m afraid, as I’ve said, this probably won’t do much good.

                                  But I understand, that a native support would be the preferred solution.

                                  1 Reply Last reply Reply Quote 0
                                  • Alan KilbornA
                                    Alan Kilborn @N iels
                                    last edited by

                                    @N-iels said :

                                    It slows Notepad++ down dramatically, to the point that working with a medium-size sequence file (500 k chars, mostly dashes) becomes impossible.

                                    @Ekopalypse said :

                                    Since the script only colors the current visual area, you seem to have very long lines with many hits, which leads to delays.

                                    @Ekopalypse Deja vu? :-)

                                    EkopalypseE 1 Reply Last reply Reply Quote 2
                                    • PeterJonesP
                                      PeterJones @N iels
                                      last edited by

                                      @N-iels said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                                      I could not find a useful macro documentation that is online

                                      There is an overview of recording macros in the official documentation at https://npp-user-manual.org/docs/macros/, and a more-detailed description of the <Macros> section of shortcuts.xml at https://npp-user-manual.org/docs/config-files/#macros, with links to the list of Notepad++ and Scintilla messages that the <Action> tags can refer to.

                                      1 Reply Last reply Reply Quote 2
                                      • EkopalypseE
                                        Ekopalypse @Alan Kilborn
                                        last edited by

                                        @Alan-Kilborn

                                        hehe :-) I guess :-D
                                        Sometimes rectangles might be useful :-)) (@all sorry, that’s an insider)

                                        1 Reply Last reply Reply Quote 0
                                        • Alan KilbornA
                                          Alan Kilborn
                                          last edited by Alan Kilborn

                                          @N-iels said :

                                          Understanding and editing the macro code is almost impossible

                                          TBH, most people never attempt to edit it, except maybe to slightly tweak it, or to do something that is not normally possible. What people do is to record their actions with the macro recorder. @guy038 probably did this when deriving his solution, followed possibly by some hand-tweaking.

                                          It would be nice to have the same algorithm in Python Script

                                          I think the macro solution is a good one. While it would be possible to duplicate the functionality with Pythonscript, I don’t know that it is worth the effort, except maybe for instructional (how would one do it) purposes…hmmm…

                                          1 Reply Last reply Reply Quote 0
                                          • PeterJonesP
                                            PeterJones
                                            last edited by

                                            @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

                                            except maybe for instructional (how would one do it) purposes

                                            Beat you to it. :-)

                                            # encoding=utf-8
                                            """in response to https://notepad-plus-plus.org/community/topic/18512/
                                            
                                            Convert this MACRO into PythonScript
                                            
                                                    <Macro name="ADN Test" Ctrl="no" Alt="no" Shift="no" Key="0">
                                                        <Action type="2" message="0"    wParam="43032" lParam="0" sParam=""  />   <!--  DELETE ALL styles        --> <!-- NPPM_ -->
                                                        <Action type="0" message="2453" wParam="0"     lParam="0" sParam=""  />   <!--  Go to START of line      --> <!-- SCI_ NoString -->
                                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="A" />   <!--  Write the letter A       --> <!-- SCI_ YesString -->
                                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="T" />   <!--  Write the letter T       --> <!-- SCI_ YesString -->
                                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="G" />   <!--  Write the letter G       --> <!-- SCI_ YesString -->
                                                        <Action type="1" message="2170" wParam="0"     lParam="0" sParam="C" />   <!--  Write the letter C       --> <!-- SCI_ YesString -->
                                                        <Action type="0" message="2453" wParam="0"     lParam="0" sParam=""  />   <!--  Go to START of line      --> <!-- SCI_ NoString -->
                                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                                        <Action type="2" message="0"    wParam="43022" lParam="0" sParam=""  />   <!--  Apply the 1st STYLE      --> <!-- NPPM_ -->
                                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                                        <Action type="2" message="0"    wParam="43024" lParam="0" sParam=""  />   <!--  Apply the 2nd STYLE      --> <!-- NPPM_ -->
                                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                                        <Action type="2" message="0"    wParam="43026" lParam="0" sParam=""  />   <!--  Apply the 3rd STYLE      --> <!-- NPPM_ -->
                                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                                        <Action type="0" message="2307" wParam="0"     lParam="0" sParam=""  />   <!--  Select the NEXT char     --> <!-- SCI_ NoString -->
                                                        <Action type="2" message="0"    wParam="43030" lParam="0" sParam=""  />   <!--  Apply the 5th STYLE      --> <!-- NPPM_ -->
                                                        <Action type="0" message="2306" wParam="0"     lParam="0" sParam=""  />   <!--  Hit the RIGHT key        --> <!-- SCI_ NoString -->
                                                        <Action type="0" message="2454" wParam="0"     lParam="0" sParam=""  />   <!--  Select to START of line  --> <!-- SCI_ NoString -->
                                                        <Action type="0" message="2180" wParam="0"     lParam="0" sParam=""  />   <!--  Hit on the DELETE key    --> <!-- SCI_ NoString -->
                                                    </Macro>
                                            
                                            https://www.bioinformatics.org/sms2/random_dna.html
                                            
                                            catctaaagggattagttcctgccctcatattcactatccgacccctttaactgtgatgt
                                            cctcgctttttctcgtgagagctgtgaatctttgtgccgtttccaacaaggcctggagcc
                                            ttttcaatgcttgagggtttcaccgcgggtctaacggatgctaagaaaggggtgcggagg
                                            aagggtctttatgctggccgtcggcggttgagagctctgacctataccatggatcccgcg
                                            agcgcggttacgggcaataagggcctcactatgcctcgaacacattgtggacaaagtgta
                                            gtcgaacccacacacgcgcgagactttagggtgtcgaacagtaccatctaattgatggga
                                            agaaatggtttcgtaccacccccgtcgctcagcttagacgggccagagaggggatgggtg
                                            gtcagtggcgtcggttggtgaccgtagaattcgttacagagcgatgttgtatagcttttt
                                            agacgtaggctagcgttttaacttctacaactccagtgattgggttgatggtctgtttgc
                                            ttaccagtcaggtcagctcccgctcatggttctctcgcaaattacttggtcacaccgtga
                                            aagctccacgcaaactaatagtgggattctacactaaagggcgtcactatcacttcttat
                                            acattatagacgtaactacagtagacatactcgcaagcccgctaacgggagcacagatgt
                                            tgagggtatcagcttctgcgactcgggctggatccgatatttttatgcaatgcatctgag
                                            actggcctccctgctacctctacggaagctggtacgaagcgcgctgccttcgactgaaac
                                            ttgcatgcataagttaatgtagtgcagcgcaggtcagccaacataagtagtgagcccagc
                                            cgctggcaggacagttgtcgcggtaaatcacacgtgtggtgaccatctccccatttacag
                                            gtgttagaaaagcaacttcgtattaatccattaatctgag
                                            
                                            
                                            """
                                            notepad.menuCommand(43032)      #   <!--  DELETE ALL styles        -->      IDM_SEARCH_CLEARALLMARKS = Search > Unmark All > Clear All Styles
                                            editor.vCHomeWrap()             #   <!--  Go to START of line      -->
                                            editor.replaceSel("A")          #   <!--  Write the letter A       -->
                                            editor.replaceSel("T")          #   <!--  Write the letter T       -->
                                            editor.replaceSel("G")          #   <!--  Write the letter G       -->
                                            editor.replaceSel("C")          #   <!--  Write the letter C       -->
                                            editor.vCHomeWrap()             #   <!--  Go to START of line      -->
                                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                                            notepad.menuCommand(43022)      #   <!--  Apply the 1st STYLE      -->      Search > Mark All > Using 1st Style
                                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                                            notepad.menuCommand(43024)      #   <!--  Apply the 2nd STYLE      -->      Search > Mark All > Using 2nd Style
                                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                                            notepad.menuCommand(43026)      #   <!--  Apply the 3rd STYLE      -->      Search > Mark All > Using 3rd Style
                                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                                            editor.charRightExtend()        #   <!--  Select the NEXT char     -->
                                            notepad.menuCommand(43030)      #   <!--  Apply the 5th STYLE      -->      Search > Mark All > Using 5th Style
                                            editor.charRight()              #   <!--  Hit the RIGHT key        -->
                                            editor.vCHomeWrapExtend()       #   <!--  Select to START of line  -->
                                            editor.clear()                  #   <!--  Hit on the DELETE key    -->
                                            
                                            # use notepad.menuCommand(43032) or Search > Unmark All > Clear All Styles to clear the styles when done
                                            
                                            1 Reply Last reply Reply Quote 2
                                            • First post
                                              Last post
                                            The Community of users of the Notepad++ text editor.
                                            Powered by NodeBB | Contributors