Delete number strings in the middle of lines of data
-
@PeterJones said in Delete number strings in the middle of lines of data:
[0-9.E±]+ The problem with this subexpression is that it would match EEEEEEEEEEEEEEEEEEEEE or E+E-E+E-
Sure, but there are limits as to how far I’m willing to go, especially when it isn’t demonstrated (with good data sample by the OP) that it is needed. :-)
My goal was just to give the nod to @Terry-R when he said
regex is very dangerous (on the wrong data) as it provides no exceptions or “quality” control.I guess it is a language issue. I’m English-speaking all the way, but not for 100% of my life, maybe 85%?
Hmm… I wouldn’t have guessed that.I did a better calculation, it’s actually 93% of my life.
I double-checked with my mother, who at the moment is living with me. Sometimes this fact is :-) and sometimes it is :-( -
@Paul-Whaley said in Delete number strings in the middle of lines of data:
I only need the first and last two numbers of each line,
Oh what a tangled web we weave. So 4 people got 3 different answers. Now I’m confused, all 3 have a glimmer of truth from the statement the OP made. I guess we need the OP to provide more info and especially the before/after “shot” of the data.
Sorry @Alan-Kilborn I awkwardly referred to your solution, which I see you thought I meant wasn’t “up to grade”. Actually I was trying to applaud it as great use of the “negative” class of "whitespace. My beef was with the OP providing a regex from some unknown location and stating they had little knowledge of how to “edit” it to suit. I was providing a cautionary tale to them.
The 1 example line, whilst seemingly regimented data was actually not “in my mind”. Most fields were 10 characters long, the last 2 were 11 characters long. Use of the provided regex (albeit edited) would have been an issue as possibly any of the fields may have changed between the 10 and 11 characters making the use of a regex without ability to detect these changes “very dangerous”.
I understand where @PeterJones comes from with a more defined regex, however I think the one thing we CAN see in the example is the data ONLY contains scientific numbers in a “clearly” defined format. I was happy with @Alan-Kilborn use of the (negative) whitespace class to define the boundaries.
Cheers
my 2c worth
Terry -
@Terry-R said in Delete number strings in the middle of lines of data:
which I see you thought I meant wasn’t “up to grade”
Not at all !
And the “cautionary” stuff is well-noted as well. We’re all in charge of our own data.
And I think the OP was truly okay anyway unless he was going to do a backupless Replace in Files … there is always UNDO!And BTW,
\S--that’s capital S-- is getting more workout in my own regex solutions these days! -
Hello, @paul-whaley, @astrosofista, @alan-kilborn, @peterjones and All,
Truly original, these
3possible interpretations ;-)) Hence the necessity for OPs to always describe their needs, in a rigorous way !
@peterjones, I think that your regex, to catch a number, could even be improved !
First, I added the possibility to match a possible sign, in front of the number ( obvious )
Secondly, if we test your regex
\b\d+\.?\d*(?:E[+-]?\d+)?\b, against the malformed numbers, below, it wrongly matches something ! For instance, when it matches 03, in the third line the \b assertion which is a location between a non-word char and a word char suppose it’s OK as, the minus sign, before 03 is, indeed, a non word char !.5 Wrongly matches the string 5 .5E+02 Wrongly matches the string 5E+02 .E-03 Wrongly matches the string 03 .E+07 Wrongly matches the string 07 23. Wrongly matches the string 23So, here is my solution, which do not use at all the
\bassertion :(?<![.\w+-])[+-]?\d+(?:\.\d+)?(?:E[+-]?\d+)?(?![.\w]), meaning that any number :-
Cannot be preceded by, either, a word character, the decimal dot
., the+sign or the-sign -
Cannot be followed by, either, a word character or the decimal dot
.
Now, I’m going to tell you about a little-known structure : a conditional regex syntax,
(?(Condition)........), where the condition is the reserved wordDEFINE, in upper case. The condition DEFINE is alwaysFALSEso the contents of this conditional structure will never be part of the regex.It seems pointless ! Make no mistake : it allows you to define a kind of library of regular expressions, which you can use, at your leisure, to build your effective regular expression ;-))
For instance, let’s suppose we want to match a
IPV4address : Each of the4parts are a byte, with value from 0 to 255. To get this integer, we must build the regex25[0-5]|2[0-4]\d|1\d\d|[1-9]?\dNow, the general form of a
IPV4address is \bByte(.Byte){3}\b. Thus, in order to match anIPV4address, we may use the conditionalDEFINEsyntax, below :(?(DEFINE)(25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d))\b(?1)(\.(?1)){3}\b
You could say: why don’t you prefer the simple regex, below ?
\b(25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d)(\.(?1)){3}\bWell, let’s suppose that there are
3different ways to match anIPV4address :Then, your regex would have been changed into :
\b((25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d)(\.(?1)){3}|...2nd alternative...|...3rd alternative...)\bBut, when the
2ndor3rdalternative matches, the group1is not defined any more and you cannot use it in the other alternatives ! With the conditionalDEFINEsyntax, there is still possible :(?(DEFINE)(25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d))\b((?1)(\.(?1)){3}|...2nd alternative...|...3rd alternative)\b
BTW, even using the simple syntax, it’s important to see the difference between these two regexes :
-
\b(25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d)(\.\1){3}\b -
\b(25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d)(\.(?1)){3}\b
Well :
-
The former regex would only match
IPV4addresses like 45.45.45.45, 0.0.0.0, 127.127.127.127, as the back-reference\1refers to the value of group1 -
Whereas the later would find any valid
IPV4address, because the(?1)syntax are similar to a subroutine, in a programming language, and refers to regex itself25[0-5]|2[0-4]\d|1\d\d|[1-9]?\d
Let’s go back to the
DEFINEcondition. The nice thing is that it allows you to define more than one regex/group :For instance, let’s imagine that you analyze a DNA genetic sequence and that you want to highlight certain combinations of the
3elementary parts, below :-
ATT.{12,}?ATT( ZoneA) -
TAG.{9}TAG( ZoneB) -
CCC.*?CCC( ZoneC)
Now, from these elementary parts, let’s assume that the combinations we’re looking for, in this DNA sequence, are three :
-
ACCCTTTB -
CAC -
BGATCGATA
Then, you could build the regex :
(?(DEFINE)(ATT.{12,}?ATT)(TAG.{9}TAG)(CCC.*?CCC))(?1)CCCTTT(?2)|(?3)(?1)(?3)|(?2)GAT(?3)GAT(?1)or, with the Free-spacing mode :
(?x) (?(DEFINE) (ATT.{12,}?ATT) (TAG.{9}TAG) (CCC.*?CCC)) (?1)CCCTTT(?2) | (?3)(?1)(?3) | (?2)GAT(?3)GAT(?1)Any alternative, in the right part of the regex, is functional, because the elementary parts
A,BandCare defined, once and for all, due to the conditionalDEFINEstructure in the left part of the regexTest these two regex syntaxes against the DNA sequence, below :
GCTAATTCGGCTGATATCGATTCCCTTTTAGGGACTTACGTAGCCATGGATCCCATGCATGCCCATTCGGCTGATATCGATTCCCTGCCCGGATTTCTAGGGACTTACGTAGGATCCCATGCATGCCCGATATTCGGCTGATATCGATTTAAGGGCTA
To end, let’s apply all these notions to the OP’s problem :
Let’s assume this single line of numbers :
+1.1111E-01 -2.2222E+02 +3.3333E-03 -4.4444E+04 5.5555E-05 +6.6666E+06 -7.7777E-07 8.8888E+08 -9.9999E-09If we use the conditional
DEFINEstructure and the free-spacing mode(?x), you can write, these3following regexes :SEARCH : Regex A : (?x-si) (?(DEFINE) ( (?<![.\w+-]) [+-]?\d+(?:\.\d+)?(?:E[+-]?\d+)? (?![.\w]) ) ) .*? ( ^ (?1)\h | (?1) $ ) # @Alan flavor Regex B : (?x-si) (?(DEFINE) ( (?<![.\w+-]) [+-]?\d+(?:\.\d+)?(?:E[+-]?\d+)? (?![.\w]) ) ) .*? ( ^ (?1)\h | (?1)\h(?1) $ ) # @Astrosofista flavor Regex C : (?x-si) (?(DEFINE) ( (?<![.\w+-]) [+-]?\d+(?:\.\d+)?(?:E[+-]?\d+)? (?![.\w]) ) ) .*? ( ^ (?1)\h(?1)\h | (?1)\h(?1) $ ) # @PeterJones flavor REPLACE : \2And we get the
3results below :+1.1111E-01 -9.9999E-09 @Alan flavor , with Regex A +1.1111E-01 8.8888E+08 -9.9999E-09 @Astrosofista flavor , with Regex B +1.1111E-01 -2.2222E+02 8.8888E+08 -9.9999E-09 @PeterJones flavor , with Regex CBest Regards,
guy038
-
-
@guy038 said in Delete number strings in the middle of lines of data:
(?(DEFINE)…)
It’s a nice construct. It is documented here for those that don’t know:
https://www.boost.org/doc/libs/1_70_0/libs/regex/doc/html/boost_regex/syntax/perl_syntax.html
as
(?(DEFINE)never-exectuted-pattern) Defines a block of code that is never executed and matches no characters: this is usually used to define one or more named sub-expressions which are referred to from elsewhere in the pattern.I don’t think it has a mention in the official Notepad++ docs, though.
It doesn’t mean a lot if you simply read it, but a lot of value is added with a concrete example such as that provided by @guy038
One thing that I don’t like about it is that it consumes a capture group number. Wouldn’t it be better to work with named and not numbered groups? Indeed the docs say “…define one or more named sub-expressions…” so this would be equivalent for “my” regex (regex A) above:
(?x-si) ( ?(DEFINE) (?<ALAN> (?<![.\w+-]) [+-]?\d+(?:\.\d+)?(?:E[+-]?\d+)? (?![.\w]) ) ) (^(?P>ALAN)\h|(?P>ALAN)$)But alas, even though I’ve used a group named
ALANabove, it is equivalent to group #1, thus a possible equivalency use case could look like this:(?x-si) ( ?(DEFINE) (?<ALAN> (?<![.\w+-]) [+-]?\d+(?:\.\d+)?(?:E[+-]?\d+)? (?![.\w]) ) ) (^(?1)\h|(?1)$)Note that the difference is, even though I’ve named the group
ALANat “define” time, I refer to it as1when actually used.So why is this a downside? Well, because it couples the left side (definition) with the right side (use). Maybe I have a library of definitions, that I want to largely ignore (except their names), and I’m wanting to write a regex I’m going to use to match some data–maybe in the regex I want to backrefer to my own capture group #1. Well, because of the coupling, group #1 would already be in use.
Ok, so maybe it is a slight downside that wouldn’t come up often, but, I just happened to encounter that scenario recently… :-)
Did this turn into a Boost regex forum accidentally, or what?!? So sorry…
-
Hi, @alan-kilborn and All,
Yes, Alan, I’m agree with you that named groups should not be numbered by the regex engine and, thus, the user should only use them, as backreferences, with their names, in search and/or replacement !
However, the
.NETregex engine, has an intelligent way to have the best of both worlds ! Indeed, the.NETregex engine scans all unnamed groups, first, numbering them from value1, then re-scans the regex, continuing to number all the named groups, from after the greatest number used in unnamed groups ;-))In the old version, below, of the
Regular-Expressionsmanual, ofJan Goyvaerts( creator of theRegular-expressions.infosite ),https://www.princeton.edu/~mlovett/reference/Regular-Expressions.pdf
it is said, pages
36-37Names and Numbers for Capturing Groups :
Here is where things get a bit ugly. Python and PCRE treat named capturing groups just like unnamed capturing groups, and number both kinds from left to right, starting with one. The regex
(a)(?P<x>b)(c)(?P<y>d)matches abcd as expected. If you do a search-and-replace with this regex and the replacement\1\2\3\4, you will get abcd. All four groups were numbered from left to right, from one till four. Easy and logical.Things are quite a bit more complicated with the .NET framework. The regex
(a)(?<x>b)(c)(?<y>d)again matches abcd. However, if you do a search-and-replace with$1$2$3$4as the replacement, you will get acbd. Probably not what you expected.The .NET framework does number named capturing groups from left to right, but numbers them after all the unnamed groups have been numbered. So the unnamed groups (a) and (c) get numbered first, from left to right, starting at one. Then the named groups
(?<x>b)and(?<y>d)get their numbers, continuing from the unnamed groups, in this case: three.To make things simple, when using .NET’s regex support, just assume that named groups do not get numbered at all, and reference them by name exclusively.
But, with the
Boostregex engine of Notepad++, we have to make do with the usual numbering of the groups, which just does one regex scan and numbers any group, named or not, one after the other !Best Regards,
guy038
-
Maybe getting really off-topic now, but with the “DEFINE” stuff it got me thinking about a similar “problem” I have. I say “problem” because it is nothing I can’t workaround, but I’m wondering if there is a better solution.
Consider:
search:
(?-i)(Xxx)|(XXX)|(Yyy)
replace:(?1Zzz)(?2ZZZ)(?3Www)This would convert this text:
The quick Xxx Yyy jumped over the lazy XXXintoThe quick Zzz Www jumped over the lazy ZZZSo please don’t consider the wrong problem. What I have is a simplified example of something more complicated, and the above is just for illustration.
What I’d like to do is to NOT have to specify the capitalized version of
ZZZin the replace, but rather use theZzztext without respecifying it (important!) in combination with a\Uoption.So in pseudo-regex, because I know this won’t work, without even trying it:
replace:
(?1Zzz)(?2\U${1}\E)(?3Www)So I was just wondering if you had any thoughts on this. TIA. :-)
-
Hi, @alan-kilborn,
Your replacement cannot work because, when the search regex matches the string
XXX, due to the different alternatives, the group2is the only group defined, anyway :-((In addition, seemingly, you’re not interested by the group
1, itself, but only with the replacement string of this group , so that you would like something like(?2\UREPLACEMENT of (\1)\E)!!
Let’s imagine the text sample, below, which is used in all subsequent tests :
Xxx XXX XXX---XxxThen with the regex S/R :
SEARCH (?x-i) ^(Xxx)$ | ^(XXX)$ | (\2---\1) Groups : 1 2 3 REPLACE \r\nGroup 1 >\1<\r\nGroup 2 >\2<\r\nGroup 3 >\3<\r\nWe get :
Group 1 >Xxx< Group 2 >< Group 3 >< Group 1 >< Group 2 >XXX< Group 3 >< XXX---XxxAs explained above, the search regex does match the
XxxandXXXstrings but fails to find theXXX---xxxbecause when trying the3rdalternative, the groups\1and\2are not defined
OK, let’s try another syntax, using sub-routine calls
(?#):SEARCH (?x-i) ^(Xxx)$ | ^(XXX)$ | ((?2)---(?1)) Groups : 1 2 3 REPLACE \r\nGroup 1 >\1<\r\nGroup 2 >\2<\r\nGroup 3 >\3<\r\nText turns into :
Group 1 >Xxx< Group 2 >< Group 3 >< Group 1 >< Group 2 >XXX< Group 3 >< Group 1 >< Group 2 >< Group 3 >XXX---Xxx<This time, the result is better as, when matching the string
XXX---xxx, with the alternative((?2)---(?1)), it makes reference to groups1and2, outside the alternative matched, due to the(DEFINE)syntax !However, we don’t get the groups
1and2, individually
Let’s use, again, an other syntax, where any sub-routine call
(?#)is embedded in parentheses, itself, so((?#))SEARCH (?x-i) ^(Xxx)$ | ^(XXX)$ | ((?2))---((?1)) Groups : 1 2 3 4 REPLACE \r\nGroup 1 >\1<\r\nGroup 2 >\2<\r\nGroup 3 >\3<\r\nGroup 4 >\4<\r\nJust note that the
3rdalternative is not embedded, itself, between parentheses. After execution, we’re left with :Group 1 >Xxx< Group 2 >< Group 3 >< Group 4 >< Group 1 >< Group 2 >XXX< Group 3 >< Group 4 >< Group 1 >< Group 2 >< Group 3 >XXX< Group 4 >Xxx<Ah!.. ,now, when the regex engine tries the
3rdalternative, it does match the stringXXX-Xxxand, in replacement, we note that groups3and4( which are identical to groups2and1, respectively, not part of the present match ), are both defined :-))So, using a more natural example, below :
SEARCH (?x-i) ^(Xxx)$ | ^(XXX)$ | ((?2))---((?1)) Groups : 1 2 3 4 REPLACE (?1ABC)(?2DEF)(?3Group 1 = \4 and Group 2 = \3)The sample text :
Xxx XXX XXX---Xxxis changed into :
ABC DEF Group 1 = Xxx and Group 2 = XXX
However, there’s still a problem, as, in your example, you would like to refer to the replacement part of a group, which does not participate to the overall match, anyway ! More complicated…
We must find a way :
-
To match and capture the string
XXX -
To capture the string
ZZZ, in the same alternative, although the stringZZZwould not be part of the overall match
Still searching !
Best Regards,
guy038
-
-
@guy038 I was working on a paper wen i notice i had to replace averything after a (space)
exemple 2020-04-10 21,25,25I found the pdf pud i’m just Dum
how to remove every regular expresion: 21,25,25
so everything after the year-month-day?
And sorry If I did broke few rules éditor Notepad++ -
@cracksoft said in Delete number strings in the middle of lines of data:
@guy038 I was working on a *papier wen i notice i had to replace averything after a (space)
exemple 2020-04-10 21,25,25I found the pdf pud i’m just Dum
how to remove every regular expresion: 21,25,25
so everything after the year-month-day?
And sorry If I did broke few rules éditor Notepad++
*edit -
@cracksoft **edit I may be on the right track I just found front the pdf you provide in this post space = \s if i’m not wrong?
-
Hello, @craksoft, and All,
If I fully understood your needs, you would like to delete the part after a date, which, I suppose, is the hour part ?
If so :
-
SEARCH
(?-s)(?<=\d{4}-\d\d-\d\d)\h+.{8} -
REPLACE
Leave EMPTY -
Select the
Regular expressionsearch mode
Best Regards,
guy038
P.S. :
For regex documentation, follow this link :
https://community.notepad-plus-plus.org/topic/15765/faq-desk-where-to-find-regex-documentation
-
-
@guy038 said in Delete number strings in the middle of lines of data:
(?-s)(?<=\d{4}-\d\d-\d\d)\h+.{8}
So this long thing (?-s)(?<=\d{4}-\d\d-\d\d)\h+.{8} is 6 number ?
Still thank it work you made my escape of selecting and deleting few hours of work ^^ -
Hi, @craksoft, and All,
You said :
So this long thing (?-s)(?<=\d{4}-\d\d-\d\d)\h+.{8} is 6 number ?
I don’t know what you means, exactly !?
The regex expression
(?-s)(?<=\d{4}-\d\d-\d\d)\h+.{8}deletes blanks characters and the next8characters, when preceded by a date, with theYYYY-MM-DDformat. No more, no less :-)BR
guy038
Hello! It looks like you're interested in this conversation, but you don't have an account yet.
Getting fed up of having to scroll through the same posts each visit? When you register for an account, you'll always come back to exactly where you were before, and choose to be notified of new replies (either via email, or push notification). You'll also be able to save bookmarks and upvote posts to show your appreciation to other community members.
With your input, this post could be even better 💗
Register Login