• Add shortcut for closing unsaved file?

    9
    1 Votes
    9 Posts
    4k Views
    Steven GoslingS
    @PeterJones Thank you for letting me know. As I mentioned, this was so others searching for the topic would know that an update was available already.
  • UDL: Limitations.

    udl
    6
    -1 Votes
    6 Posts
    958 Views
    UltiMaxKomU
    @PeterJones [Forenote: Sorry for the late reply. This will be my usual habit here, though, because I had many things to do in some other places - Well, those sorts of things. Also, I had some problem with composing this reply, kinda…] [1] Least likely to be updated? Hmm, that is sad, but for some reasons, I can’t really complain about it. ⠀⠀⠀For the open issues and or request not getting traction, yeah, that does sound very unfortunate… Although, I am a bit curious on why. I would like to know if there’s a problem or something regarding UDL development, but this isn’t necessary for me to know, so I could pass on this one. [2] Hoh~? I’m not stuck? [3] Hmm, this is really interesting. Definitely gunna check those out. Thank you. [4] Write a new lexer, hum, definitely not doing it anytime “soon”… Beg or bribe to write a new lexer doesn’t sound fun… Contract or hire might be overboard for my project(?)… Requesting code changes sounds reasonable, but I’m not sure on wha- wait… Maybe I need to request the change/extra option of separators from the puny spaces to something else and the inclusion of whitespaces identifier (Since whitespaces are ignored) on a specific section. Yeah… That might work… ⠀⠀⠀Thinking about it, the change shouldn’t be to remove space as a separator or anything altogether but to add an extra option on or for all sections. A checkbox that allows an advanced user to use the advanced feature, such as this or something else - heck, regex would be super great. And then- erm… Nah. ⠀⠀⠀Realistically, that wouldn’t happen. So eh, let’s just cut it there for now. I am a bit tired for it. ⠀⠀⠀Anyhow, great reply. +1 ⠀ [Note to self: Horribly big line gaping; switch to the normal newline gap instead | Deleted Extra Note section | One missing asterisk (*) for bold format] [Note to self v2: Why can’t I edit, even after 20 minutes after posting… These notes happen because of that | Deleted unnecessary lines | A terrible mistake for not following my own note]
  • Remove "yes, for all", "no, for all" when not needed

    4
    1
    -1 Votes
    4 Posts
    583 Views
    Alan KilbornA
    @DeLiXx said in Remove "yes, for all", "no, for all" when not needed: A good strategy would be to showcase the new feature with the greyed out buttons in a single major version as it’s being done now and hide it as suggested for all following releases. I respectfully disagree that that is a good strategy.
  • Incremental Search

    3
    1 Votes
    3 Posts
    645 Views
    BBandsB
    Works for me. Thanks, John
  • [Feature Request] Undo for Auto-Insert: tags and parentheses

    9
    0 Votes
    9 Posts
    1k Views
    dailD
    @Alan-Kilborn said in [Feature Request] Undo for Auto-Insert: tags and parentheses: Is this any textual change? Or is it truly any change? In the context of any change Notepad++ did that the user did not specifically do themselves. I wont say this is a hard rule though.
  • Portable version and APPDATA

    6
    0 Votes
    6 Posts
    4k Views
    Laurent DuvoisinL
    @PeterJones Thank you very much, I will try tomorrow
  • 0 Votes
    2 Posts
    433 Views
    EkopalypseE
    @Qasim-Ijaz as you reference 7.4 I assume you are using this version as well, so the obvious question would be why you don’t update to a newer version which has fixed this?
  • 1 Votes
    2 Posts
    777 Views
    dinkumoilD
    @GowaP You can use my AutoCodepage plugin for that purpose, available via Plugins Admin.
  • Notepap++ asks if the file should be reloaded after manual reload

    9
    0 Votes
    9 Posts
    2k Views
    Michi KaaM
    Interesting, thanks for the investigastion. From my experience it feels like something with getting the focus back to the file. as if “Ctrl+R” is leading to have the focus on the current file lost, after the reload it is regained. When the focus is regained, the check for modification kicks in and if the file was modified in the mean time, it asks if the file should be reloaded. If the focus is lost, maybe it is possible to reload with Ctrl+R without having the focus lost? Reading your posting reminded me on the first posting in this thread and the sidenote: since “Monitoring tail -f” doesn’t work as I expect it. The “eye-button” also known as since “Monitoring tail -f” would solve this issue, if it worked as I’d expect it. I experience the same as here: https://github.com/notepad-plus-plus/notepad-plus-plus/issues/4955
  • Docking Session Manager to right side

    3
    0 Votes
    3 Posts
    591 Views
    pbarneyP
    Sorry, I was mistaking the Session Manager plugin with the NPP Favorites plugin, which automatically shows up on the right-hand side. This also explains why my sessions were all missing. Thanks for the help.
  • Find and replace specific word between more tags

    6
    0 Votes
    6 Posts
    1k Views
    dinkumoilD
    @plidos You could install the XML Tools plugin and use its XSLT Transformation feature. Open Plugins Admin and install XML Tools plugin. After Notepad++ has been restarted paste the XSLT code from below to an empty tab and save it for example as ChangeVisible.xsl. Open the XML file you want to process. Go to (menu) Plugins -> XML Tools -> XSLT Transformation. In the dialog popping up click on the ellipsis button and in the file selector dialog popping up select the XSL file you created in step 2. In the options field of the dialog type UPCid='1234'. Click the Transform button. A new document will be opened with your changes applied. Save it to the original file. To change the value of the IsVisible node of more than one Item nodes, repeat steps 6 to 8. The XSLT code. Please note: In line 19 (<xsl:template match="/RootNode/Item/IsVisible">) you have to provide the complete path to the IsVisible XML node, starting from the document’s root node. <?xml version="1.0" encoding="UTF-8"?> <xsl:transform version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output method="xml" omit-xml-declaration="no" indent="yes" /> <xsl:param name="UPCid"/> <xsl:template match="@*|node()"> <xsl:copy> <xsl:apply-templates select="@*|node()"/> </xsl:copy> </xsl:template> <xsl:template match="/RootNode/Item/IsVisible"> <xsl:choose> <xsl:when test="../@UPC=$UPCid"> <xsl:copy> <xsl:copy-of select="@*"/> <xsl:text>False</xsl:text> </xsl:copy> </xsl:when> <xsl:otherwise> <xsl:copy> <xsl:copy-of select="@*|node()"/> </xsl:copy> </xsl:otherwise> </xsl:choose> </xsl:template> </xsl:transform>
  • Minor nuisance: "N" no longer selects "No"

    2
    0 Votes
    2 Posts
    516 Views
    PeterJonesP
    @Brian-Hart said in Minor nuisance: "N" no longer selects "No": And likely nobody else will care or even notice hehehe. https://community.notepad-plus-plus.org/topic/18544/new-v7-8-enhancement-in-save-dialog-is-missing-keyboard-shortcuts https://community.notepad-plus-plus.org/topic/18513/shortcut-keys-in-save-dialog-no-longer-working https://community.notepad-plus-plus.org/post/48004 https://github.com/notepad-plus-plus/notepad-plus-plus/issues/6223 In other words, it’s known about. Note that last one is the official issue-tracker; should be fixed in the next version released (ie, whatever comes after v7.8.1)
  • JSON file

    4
    0 Votes
    4 Posts
    3k Views
    A
    @Eran-Blecher Notepad +++ opens any text files, and the * .json extension is a text format)) Install the JSTool plugin for formatting * .JSON files, and it will become much more convenient to work with this format! [image: m3pxA1b.png]
  • 0 Votes
    4 Posts
    1k Views
    Ralph CramdenR
    @Alan-Kilborn SOLVED! I realized that I had to select Python in the drop down box, not leave it at [Default]. Thanks very much!
  • (((This is a bug)) since the first day) I join Notepad++

    8
    0 Votes
    8 Posts
    1k Views
    Alan KilbornA
    @gstavi said in (((This is a bug)) since the first day) I join Notepad++: Managed to dig the ticket I posted on sourceforge. In the linked ticket, @donho said: The current behaviour is preferable comparing with the one you suggested. He is perhaps unique in liking the behavior! :-( Of course, deciding you like the behavior is much easier than doing something to change it. :-)
  • UDL for Log files

    4
    0 Votes
    4 Posts
    948 Views
    EkopalypseE
    @Pierre-de-la-Verre UDL has been designed to support highlighting of programming languages, your use case is a little bit different to this. At the moment I see 3 ways to make this work. You write your own lexer You use a scripting plugin and enhance the already defined UDL with the missing features. By using a slightly different approach like the one mentioned by dinkumoil. When you want to make either 1 or 2 work, there is, for example, the PythonScript plugin which has a logfile lexer as an example script. In addition, I described here how one can enhance an already defined UDL with pythpn and regex.
  • How to fix the error when starting the program?

    16
    1
    0 Votes
    16 Posts
    6k Views
    makarovproM
    @dinkumoil I like notepad++, now some problems, very sorry.
  • UDL syntax highlighting: non-delimited keywords (for nucleotide sequences)

    20
    0 Votes
    20 Posts
    3k Views
    PeterJonesP
    @Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences): except maybe for instructional (how would one do it) purposes Beat you to it. :-) # encoding=utf-8 """in response to https://notepad-plus-plus.org/community/topic/18512/ Convert this MACRO into PythonScript <Macro name="ADN Test" Ctrl="no" Alt="no" Shift="no" Key="0"> <Action type="2" message="0" wParam="43032" lParam="0" sParam="" /> <!-- DELETE ALL styles --> <!-- NPPM_ --> <Action type="0" message="2453" wParam="0" lParam="0" sParam="" /> <!-- Go to START of line --> <!-- SCI_ NoString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="A" /> <!-- Write the letter A --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="T" /> <!-- Write the letter T --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="G" /> <!-- Write the letter G --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="C" /> <!-- Write the letter C --> <!-- SCI_ YesString --> <Action type="0" message="2453" wParam="0" lParam="0" sParam="" /> <!-- Go to START of line --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43022" lParam="0" sParam="" /> <!-- Apply the 1st STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43024" lParam="0" sParam="" /> <!-- Apply the 2nd STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43026" lParam="0" sParam="" /> <!-- Apply the 3rd STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43030" lParam="0" sParam="" /> <!-- Apply the 5th STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2454" wParam="0" lParam="0" sParam="" /> <!-- Select to START of line --> <!-- SCI_ NoString --> <Action type="0" message="2180" wParam="0" lParam="0" sParam="" /> <!-- Hit on the DELETE key --> <!-- SCI_ NoString --> </Macro> https://www.bioinformatics.org/sms2/random_dna.html catctaaagggattagttcctgccctcatattcactatccgacccctttaactgtgatgt cctcgctttttctcgtgagagctgtgaatctttgtgccgtttccaacaaggcctggagcc ttttcaatgcttgagggtttcaccgcgggtctaacggatgctaagaaaggggtgcggagg aagggtctttatgctggccgtcggcggttgagagctctgacctataccatggatcccgcg agcgcggttacgggcaataagggcctcactatgcctcgaacacattgtggacaaagtgta gtcgaacccacacacgcgcgagactttagggtgtcgaacagtaccatctaattgatggga agaaatggtttcgtaccacccccgtcgctcagcttagacgggccagagaggggatgggtg gtcagtggcgtcggttggtgaccgtagaattcgttacagagcgatgttgtatagcttttt agacgtaggctagcgttttaacttctacaactccagtgattgggttgatggtctgtttgc ttaccagtcaggtcagctcccgctcatggttctctcgcaaattacttggtcacaccgtga aagctccacgcaaactaatagtgggattctacactaaagggcgtcactatcacttcttat acattatagacgtaactacagtagacatactcgcaagcccgctaacgggagcacagatgt tgagggtatcagcttctgcgactcgggctggatccgatatttttatgcaatgcatctgag actggcctccctgctacctctacggaagctggtacgaagcgcgctgccttcgactgaaac ttgcatgcataagttaatgtagtgcagcgcaggtcagccaacataagtagtgagcccagc cgctggcaggacagttgtcgcggtaaatcacacgtgtggtgaccatctccccatttacag gtgttagaaaagcaacttcgtattaatccattaatctgag """ notepad.menuCommand(43032) # <!-- DELETE ALL styles --> IDM_SEARCH_CLEARALLMARKS = Search > Unmark All > Clear All Styles editor.vCHomeWrap() # <!-- Go to START of line --> editor.replaceSel("A") # <!-- Write the letter A --> editor.replaceSel("T") # <!-- Write the letter T --> editor.replaceSel("G") # <!-- Write the letter G --> editor.replaceSel("C") # <!-- Write the letter C --> editor.vCHomeWrap() # <!-- Go to START of line --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43022) # <!-- Apply the 1st STYLE --> Search > Mark All > Using 1st Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43024) # <!-- Apply the 2nd STYLE --> Search > Mark All > Using 2nd Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43026) # <!-- Apply the 3rd STYLE --> Search > Mark All > Using 3rd Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43030) # <!-- Apply the 5th STYLE --> Search > Mark All > Using 5th Style editor.charRight() # <!-- Hit the RIGHT key --> editor.vCHomeWrapExtend() # <!-- Select to START of line --> editor.clear() # <!-- Hit on the DELETE key --> # use notepad.menuCommand(43032) or Search > Unmark All > Clear All Styles to clear the styles when done
  • syntax highlighting in Knitr ".Rnw" of Latex and R

    2
    0 Votes
    2 Posts
    693 Views
    PeterJonesP
    An overview of the User Defined Languages (accessed through Language > Define Your Language…) can be found in the User Defined Languages page in the official docs. And Ivan Radić has created the definitive guide to the nuts and bolts of UDL version 2.1, which is available at https://ivan-radic.github.io/udl-documentation/ – so definitive that’s it’s linked directly from the Notepad++ UDL dialog. After looking through those docs, make an attempt at the UDL for Knitr. If you get stuck, show us what you have, how it’s not working for you, and what you would like it to do instead.
  • Find and Replace Colon Between Numbers

    4
    0 Votes
    4 Posts
    3k Views
    guy038G
    Hello, @yohanes-k, @peterjones, @ekopalypse and All, Oh, my bad ! Reading again my post, I just realize that I’m quite wrong and that the Peter’s solution is the right one ! Why ? because my search regex, in fact, is an alternative between the 2 independent regexes : \d+\K(:) and -(?=\d+) :-(( Actually, the overall regex must be an alternative between the regexes \d+\K:(?=\d+) and \d+\K-(?=\d+) which may be grouped with a ( non-capturing ) group syntax ! Now, in order to be more rigorous, we should mention the name of the Four Evangelists. This gives the following regex S/R : SEARCH (?-i:Matthew|Mark|Luke|John)\x20\d+\K:(\d+)-(?=\d+) REPLACE \x20verse\x20\1\x20to\x20 Cheers, guy038