@Alan-Kilborn said in UDL syntax highlighting: non-delimited keywords (for nucleotide sequences):

except maybe for instructional (how would one do it) purposes

Beat you to it. :-)

# encoding=utf-8 """in response to https://notepad-plus-plus.org/community/topic/18512/ Convert this MACRO into PythonScript <Macro name="ADN Test" Ctrl="no" Alt="no" Shift="no" Key="0"> <Action type="2" message="0" wParam="43032" lParam="0" sParam="" /> <!-- DELETE ALL styles --> <!-- NPPM_ --> <Action type="0" message="2453" wParam="0" lParam="0" sParam="" /> <!-- Go to START of line --> <!-- SCI_ NoString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="A" /> <!-- Write the letter A --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="T" /> <!-- Write the letter T --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="G" /> <!-- Write the letter G --> <!-- SCI_ YesString --> <Action type="1" message="2170" wParam="0" lParam="0" sParam="C" /> <!-- Write the letter C --> <!-- SCI_ YesString --> <Action type="0" message="2453" wParam="0" lParam="0" sParam="" /> <!-- Go to START of line --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43022" lParam="0" sParam="" /> <!-- Apply the 1st STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43024" lParam="0" sParam="" /> <!-- Apply the 2nd STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43026" lParam="0" sParam="" /> <!-- Apply the 3rd STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2307" wParam="0" lParam="0" sParam="" /> <!-- Select the NEXT char --> <!-- SCI_ NoString --> <Action type="2" message="0" wParam="43030" lParam="0" sParam="" /> <!-- Apply the 5th STYLE --> <!-- NPPM_ --> <Action type="0" message="2306" wParam="0" lParam="0" sParam="" /> <!-- Hit the RIGHT key --> <!-- SCI_ NoString --> <Action type="0" message="2454" wParam="0" lParam="0" sParam="" /> <!-- Select to START of line --> <!-- SCI_ NoString --> <Action type="0" message="2180" wParam="0" lParam="0" sParam="" /> <!-- Hit on the DELETE key --> <!-- SCI_ NoString --> </Macro> https://www.bioinformatics.org/sms2/random_dna.html catctaaagggattagttcctgccctcatattcactatccgacccctttaactgtgatgt cctcgctttttctcgtgagagctgtgaatctttgtgccgtttccaacaaggcctggagcc ttttcaatgcttgagggtttcaccgcgggtctaacggatgctaagaaaggggtgcggagg aagggtctttatgctggccgtcggcggttgagagctctgacctataccatggatcccgcg agcgcggttacgggcaataagggcctcactatgcctcgaacacattgtggacaaagtgta gtcgaacccacacacgcgcgagactttagggtgtcgaacagtaccatctaattgatggga agaaatggtttcgtaccacccccgtcgctcagcttagacgggccagagaggggatgggtg gtcagtggcgtcggttggtgaccgtagaattcgttacagagcgatgttgtatagcttttt agacgtaggctagcgttttaacttctacaactccagtgattgggttgatggtctgtttgc ttaccagtcaggtcagctcccgctcatggttctctcgcaaattacttggtcacaccgtga aagctccacgcaaactaatagtgggattctacactaaagggcgtcactatcacttcttat acattatagacgtaactacagtagacatactcgcaagcccgctaacgggagcacagatgt tgagggtatcagcttctgcgactcgggctggatccgatatttttatgcaatgcatctgag actggcctccctgctacctctacggaagctggtacgaagcgcgctgccttcgactgaaac ttgcatgcataagttaatgtagtgcagcgcaggtcagccaacataagtagtgagcccagc cgctggcaggacagttgtcgcggtaaatcacacgtgtggtgaccatctccccatttacag gtgttagaaaagcaacttcgtattaatccattaatctgag """ notepad.menuCommand(43032) # <!-- DELETE ALL styles --> IDM_SEARCH_CLEARALLMARKS = Search > Unmark All > Clear All Styles editor.vCHomeWrap() # <!-- Go to START of line --> editor.replaceSel("A") # <!-- Write the letter A --> editor.replaceSel("T") # <!-- Write the letter T --> editor.replaceSel("G") # <!-- Write the letter G --> editor.replaceSel("C") # <!-- Write the letter C --> editor.vCHomeWrap() # <!-- Go to START of line --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43022) # <!-- Apply the 1st STYLE --> Search > Mark All > Using 1st Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43024) # <!-- Apply the 2nd STYLE --> Search > Mark All > Using 2nd Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43026) # <!-- Apply the 3rd STYLE --> Search > Mark All > Using 3rd Style editor.charRight() # <!-- Hit the RIGHT key --> editor.charRightExtend() # <!-- Select the NEXT char --> notepad.menuCommand(43030) # <!-- Apply the 5th STYLE --> Search > Mark All > Using 5th Style editor.charRight() # <!-- Hit the RIGHT key --> editor.vCHomeWrapExtend() # <!-- Select to START of line --> editor.clear() # <!-- Hit on the DELETE key --> # use notepad.menuCommand(43032) or Search > Unmark All > Clear All Styles to clear the styles when done

An overview of the User Defined Languages (accessed through Language > Define Your Language…) can be found in the User Defined Languages page in the official docs. And Ivan Radić has created the definitive guide to the nuts and bolts of UDL version 2.1, which is available at https://ivan-radic.github.io/udl-documentation/ – so definitive that’s it’s linked directly from the Notepad++ UDL dialog.

After looking through those docs, make an attempt at the UDL for Knitr. If you get stuck, show us what you have, how it’s not working for you, and what you would like it to do instead.

Hello, @yohanes-k, @peterjones, @ekopalypse and All,

Oh, my bad ! Reading again my post, I just realize that I’m quite wrong and that the Peter’s solution is the right one !

Why ? because my search regex, in fact, is an alternative between the 2 independent regexes : \d+\K(:) and -(?=\d+) :-((

Actually, the overall regex must be an alternative between the regexes \d+\K:(?=\d+) and \d+\K-(?=\d+) which may be grouped with a ( non-capturing ) group syntax !

Now, in order to be more rigorous, we should mention the name of the Four Evangelists. This gives the following regex S/R :

SEARCH (?-i:Matthew|Mark|Luke|John)\x20\d+\K:(\d+)-(?=\d+)

REPLACE \x20verse\x20\1\x20to\x20

Cheers,

guy038

thanks!

It appears the author of Notepad++ has assigned keycombinations for these keys again (but as yet this is unreleased). See the link I referenced earlier.

He did so in the .rc file for Notepad++. I don’t know too much about how this works, but I’m thinking that will only assign keys if you never change the Localization settings in the Preferences?

If you change localization, what will happen is that a language file will be used which won’t have those keys assigned. Isn’t what truly is needed is those keys to be assigned in all of the language files as well?

There is a plugin called XML Tools which can be used to
check the syntax of an xml file and, if you are having a schema file for your
xml file, you can check if the xml data itself is valid.

@gnulab-id

You can set printing to “Black on white” in preferences Dialog:

5ee5a228-3440-41f1-8f27-baca52142cf3-grafik.png

Plugins options are stored in %AppData%\Notepad++\... hierarchy, the same as Notepad++ options. If you have the cloud setting (Settings > Preferences > Cloud) enabled for Notepad++, that moves it into the appropriate cloud directory; the Plugin options should be moved into that cloud directory as well.

However, the plugins themselves are stored in the executable directory hierarchy; you could just copy the <notepad++.exe directory>\plugins hierarchy over to the new computers

Many thanks, dinkumoil,

for the instructions, very easily done. Works great! Many thanks again!

That is perfect. If it screws me up later in some unexpected way, then I suppose it will not be perfect, but it sure works for now!

@Alan-Kilborn thanks - i re-installed 7.7.1

@dinkumoil said in Notepad ++ does not respond to formatting:

The Global override style under Stilbeschreibung is the fall-back style that comes into play if all other rules for assigning a style to a certain piece of text don’t apply on that text or if a rule lacks some of the data that make up a style (for example the font size).

Quibble: the Global override style is the style that gets applied to every type of highlighted text, as long as the override switch for that attribute (font, size, bold, italic, underline, foreground, background) is enabled. Since the OP has none of the override enables set, then the Global Override style attributes won’t take effect.

You should try changing the Default Style style.

I agree. The Default Style is the fall-back style that applies if no other highlighting rules take effect for a given piece of text. So, yes, the OP should be changing the Default Style if it is desired to change the default values for font, size, color, etc.

Hello, @simone-fusi, @prahlad-makwana4145, @dinkumoil and All,

May be, @prahlad-makwana4145, it would have been fair to mention that your method was, first, described by @dinkumoil , in that post, below :

https://community.notepad-plus-plus.org/post/37160

Unfortunately, this nice work-around does not seem to work anymore, with new N++ versions. Indeed, I do get a bigger Find dialog window, with all text enlarged but the font and size, inside the 4 zones Find what :, Replace with :, Filters : and Directory : are unchanged :-((

Note that I currently use an old laptop, with Win XP SP3 operating system, which could explain why I got no success !

Best Regards,

guy038

@Ittipan-Langkulanon said:

Could someone bring this feature on Notepad++ too?

Yes, you can do it by yourself. Remap the keyboard shortcuts for Move Up Current Line and Move Down Current Line using Shortcut Mapper ((menu) Settings -> Shortcut Mapper -> (register) Main menu).

Hello, @jakang-chen and All,

Seemingly, you need to search for any range of consecutive lowercase letters a, embedded between the uppercase letters A and B and replace each of them with the lowercase letter c

Here is a possible solution :

So, given this sample text, below :

aaa AB CB AC BC AB aaa aaa AaB CaB AaC BaC AaB aaa aaa AaaB CaaB AaaC BaaC AaaB aaa aaa AaaaB CaaaB AaaaC BaaaC AaaaB aaa aaa AaaaaB CaaaaB AaaaaC BaaaaC AaaaaB aaa aaa AaaaaaB CaaaaaB AaaaaaC BaaaaaC AaaaaaB aaa aaa AaaaaaaB CaaaaaaB AaaaaaaC BaaaaaaC AaaaaaaB aaa aaa AaaaaaaaB CaaaaaaaB AaaaaaaaC BaaaaaaaC AaaaaaaaB aaa aaa AaaaaaaaaB CaaaaaaaaB AaaaaaaaaC BaaaaaaaaC AaaaaaaaaB aaa aaa AaaaaaaaaaB CaaaaaaaaaB AaaaaaaaaaC BaaaaaaaaaC AaaaaaaaaaB aaa aaa AaaaaaaaaaaB CaaaaaaaaaaB AaaaaaaaaaaC BaaaaaaaaaaC AaaaaaaaaaaB aaa

If you run this regex S/R :

SEARCH (?-si)(A\K|\G)a(?=\w*?B)

REPLACE c

You should get your expected text :

aaa AB CB AC BC AB aaa aaa AcB CaB AaC BaC AcB aaa aaa AccB CaaB AaaC BaaC AccB aaa aaa AcccB CaaaB AaaaC BaaaC AcccB aaa aaa AccccB CaaaaB AaaaaC BaaaaC AccccB aaa aaa AcccccB CaaaaaB AaaaaaC BaaaaaC AcccccB aaa aaa AccccccB CaaaaaaB AaaaaaaC BaaaaaaC AccccccB aaa aaa AcccccccB CaaaaaaaB AaaaaaaaC BaaaaaaaC AcccccccB aaa aaa AccccccccB CaaaaaaaaB AaaaaaaaaC BaaaaaaaaC AccccccccB aaa aaa AcccccccccB CaaaaaaaaaB AaaaaaaaaaC BaaaaaaaaaC AcccccccccB aaa aaa AccccccccccB CaaaaaaaaaaB AaaaaaaaaaaC BaaaaaaaaaaC AccccccccccB aaa

It’s easy to verify that contents have changed, only between the individual ranges A............B

Notes :

The in-line modifier (?-i) ensures that the search will be processed in a NON-insentive way

The in-line modifier (?-s) forces the regex engine to consider any dot ( . ) as representing a single standard character ( and not an EOL char )

The A obvioulsy matches the litteral uppercase letter A

Then the \K syntax immediately cancels any previous match and resets the regex engine working position

If a letter A is not found, the second part of the alternative, \G, which represents the zero-length location right after the previous match, is invoked

Now, the regex engine tries to match the lower-case letter a, but ONLY IF  the positive look-ahead (?=\w*?B) is true, i.e this letter is followed by any range, even null, of word characters, till an upper-case letter B

If so, it is simply replaced with the lower-case letter c

Best Regards,

guy038

Various portions were down for at least a few hours earlier this weekend, and the whole site may have been down for at least part of it.

https://github.com/notepad-plus-plus/npp-usermanual/issues/51

@guy038
Thanks! I should have mentioned that I figured the table was wrong also and had to experiment to get my script to work. I didn’t document like you did though … Bravo!

Cheers.

@PeterJones said in How changing several similar HTML tags by RegEx?:

You are my hero, thanks very much, working!

There is a resistance to adding new controls to the UI. Or at least their seems to be. I can understand it; they take screen real-estate, and anything that is added with text on it has to be made translatable into dozens of languages. Oh, and maybe “Get” doesn’t translate to something short-and-sweet in Italian, for example, so the button has to be a certain size (bigger!). So it all gets burdensome quickly.

It might be cool to have a double-click on the Find-what label do your “get” functionality, but UI purists will bash me for endorsing such a hidden and easter-eggish thing. But, with that there would be no screen real estate consumed, and no variable-sized text to translate into many languages.

But maybe I’m missing something about your scenario. If you have some selected text in your document, if you press ctrl+f then that selected text is transferred to the Find-what box in the Find window, automagically. There is no “close dialog, re-select text and re-open the dialog” steps needed. Or perhaps I misunderstand. If so, please enlighten me.

There was a similar request recently for a button to swap the text of the Find-what and Replace-with boxes. I think it just had a symbol in it (nothing to translate) and the button itself was quite small. This request gained no traction.

Why not spec out a complete redesign of the Find UI right here with mocked-up screenshots and text? That way you don’t have to program anything so the programming language isn’t an issue. Then, if someone that can program it agrees, they can try their hand at it?

You seemed to do a lot of saying “this is bad… that is bad…” but to this point haven’t provided a lot of specifics on what changes should be made. To be fair, though, you have provided some general ideas. I’d like to see that turned into some really concrete specs for a redesign.

Again, good discussion, thank you for that.